Soluble Type II Transforming Growth Factor- (TGF- ) Receptor Inhibits TGF- Signaling in COLO-357 Pancreatic Cancer Cells in Vitro and Attenuates Tumor Formation

Human pancreatic ductal adenocarcinomas overexpress transforming growth factors (TGFs). This overexpression has been correlated with decreased patient survival. TGFs bind to a type II TGFreceptor (T RII) dimer, which heterotetramerizes with a type I TGFreceptor (T RI) dimer, thereby activating downstream signaling. Purpose and Experimental Design: To determine whether blocking TGFactions would suppress pancreatic cancer cell growth in vivo, we expressed a soluble T RII, encoding amino acids 1–159 of the extracellular domain in COLO-357 human pancreatic cancer cells. This cell line expresses all of the three mammalian TGFisoforms and is growth inhibited by TGFin vitro. Results: COLO-357 clones expressing soluble T RII were no longer growth inhibited by exogenous TGF1 and exhibited a marked decrease in their invasive capacity in vitro. When injected s.c. into athymic mice, these clones exhibited attenuated growth rates and angiogenesis and decreased levels of plasminogen activator inhibitor-1 mRNA as compared with tumors formed by sham-transfected cells. Conclusions: These results indicate that endogenous TGFs can confer a growth advantage in vivo to a pancreatic cancer cell line that is growth inhibited in vitro and suggest that a soluble receptor approach can be used to block these tumorigenic effects of TGFs. INTRODUCTION Mammalian cells express three TGF3 isoforms that regulate many cellular processes (1). They inhibit the growth of cells of epithelial origin and modulate differentiation, migration, deposition of the extracellular matrix, immunosuppression, motility, and cell death (1). They signal by binding to a T RII dimer that heterotetramerizes with a T RI homodimer (1). This leads to the phosphorylation of signaling pathway specific Smad2 and Smad3 molecules that oligomerize with the common mediator, Smad4 (1). The resulting complexes translocate to the nucleus where they regulate gene transcription (1). In contrast, the T RIII is devoid of signaling capabilities and acts to enhance ligand binding to T RII (1). Human pancreatic cancer is the fifth leading cause of cancer related mortality in the Western industrialized countries. The mortality rate virtually equals its incidence rate (2). The reasons for this biological aggressiveness are unknown. However, it has been established that these cancers harbor p53 tumor suppressor gene and K-ras oncogene mutations and overexpress multiple mitogenic growth factors and their receptors (3, 4). In addition, 50% of these cancers have Smad4 mutations (5), and many exhibit inactivating mutations or deletions in the p15 and p16 genes (6, 7). These mutations may cause these tumors to be resistant to TGF-mediated growth inhibition. However, pancreatic cancers overexpress all of the three TGFs, and this overexpression has been correlated with decreased patient survival (8). The mechanisms by which TGFs confer a growth advantage to pancreatic cancer cells in vivo have not been elucidated. In the current study, we used a soluble receptor approach to block the local actions of TGFin a s.c. nude mouse model of pancreatic cancer. To this end, we generated a cDNA encoding a human soluble T RII receptor and stably transfected this construct into the human pancreatic cancer cell line, COLO-357. These cells express all of the three TGFisoforms and are growth inhibited by TGF1 in vitro in conjunction with increased expression of the mammalian cyclin-dependent kinase inhibitors p15, p21, and p27 (9, 10). They also express a functional Smad4 gene, and their T RI and T RII genes are not mutated (10–12). Furthermore, COLO-357 cells engineered to overexpress inhibitory Smad6 or Smad7 are no longer growth inhibited by TGF1 (13, 14). Surprisingly, overexpression of Smad7 is also associated with enhanced anchorage-independent growth and increased tumorigenicity in nude mice (14), raising Received 4/25/01; revised 6/7/01; accepted 6/15/01. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 Partially supported by United States Public Health Service Grant CA-75059, awarded by the National Cancer Institute [to M. K.], and by a postdoctoral fellowship award from the George E. Hewitt Foundation for Medical Research [to M. A. R-G.] 2 To whom requests for reprints should be addressed, at Division of Endocrinology, Diabetes, and Metabolism, Medical Sciences I, C240, University of California, Irvine, CA 92697. Phone: (949) 824-2272; Fax: (949) 824-1035; E-mail: [email protected]. 3 The abbreviations used are: TGF, transforming growth factor; T R, TGF receptor; FBS, fetal bovine serum; HA, hemagglutinin A; MTT, 3-(4,5-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PAI-1, plasminogen activator inhibitor-1. 2931 Vol. 7, 2931–2940, September 2001 Clinical Cancer Research Research. on September 22, 2017. © 2001 American Association for Cancer clincancerres.aacrjournals.org Downloaded from the possibility that COLO-357 cell-derived TGFs promote cancer growth in vivo. It is not known, however, whether inhibiting the biological actions of COLO-357 cell-derived TGFs would attenuate the in vivo growth of these cells. We now report that COLO-357 clones expressing the soluble T RII exhibit attenuated growth inhibition in vitro in response to TGF1 when compared with the sham-transfected cells. These clones also demonstrate a decreased invasive capacity in vitro, as well as a decreased capacity to form tumors in nude mice and attenuated angiogenesis in vivo. MATERIALS AND METHODS Materials. The following materials were purchased: FBS, DMEM medium, trypsin solution, penicillin-streptomycin solution, and Geneticin (G418) from Irvine Scientific (Santa Ana, CA), Amplitaq DNA Polymerase from Perkin-Elmer (Norwalk, CT), restriction enzymes, pMH vector from BoehringerManheim (Indianapolis, IN), PCR primers from Bio-Synthesis, Inc. (Lewisville, TX), TA cloning pCRII vector from Invitrogen (Carlsbad, CA), mini-plasmid DNA purification kit from Promega (Madison, WI), maxi-DNA plasmid purification preparation kit and DNA gel extraction kit from Qiagen (Thousand Oaks, CA), Sequenase version 1.0 DNA sequencing from USB Specialty Biochemicals (Cleveland, OH), Genescreen membranes from New England Nuclear (Boston, MA), random primed labeling kit from Ambion (Austin, TX), [ P]dCTP and [ S]dATP from Amersham (Arlington Heights, IL), TE Select D G50 columns from 5 Prime33 Prime, Inc. (Boulder, CO), DNA and protein molecular weight markers, Lipofectamine from Life Technologies, Inc. (Gaithersburg, MD), anti-HA, anti-ERK-2, anti-T RII antibodies and protein A agarose from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), biotinylated antihuman T RII polyclonal antibody from R&D Systems, Inc. (Minneapolis, MN), horseradish peroxidaseconjugated antibodies from Bio-Rad (Hercules, CA), PECAM-1 monoclonal antibody (clone C/70A) from Oncogene Research Products (Cambridge, MA), enhanced chemiluminescence substrate and Restore Stripping Buffer from Pierce (Rockford, IL), Vectastain Universal Elite ABC kit from Vector Labs (Burlingame, CA), Immobilon-P nitrocellulose membranes from Millipore Corp. (Bedford, MA), streptavidin-peroxidase from Kirkegaard and Perry Laboratories, Inc. (Gaithersburg, MD), centriprep concentrators from Amicon Inc. (Beverly, MA), LabTek chamber slides from Nunc Inc. (Naperville, IL), Transwell chambers from Costar (Cambridge, MA), Matrigel from Becton Dickinson (Bedford, MD), and all of the other reagents from Sigma Chemical Co. (St. Louis, MO). COLO-357 human pancreatic cancer cells were a gift from Dr. Richard S. Metzgar (Duke University, Durham, NC). TGF1 was a gift from Genentech, Inc. (South San Francisco, CA). Human dermal microvascular endothelial cells were a gift from Dr. Joyce Bischoff (Children’s Hospital, Harvard University Medical School, Boston, MA) and Dr. Jian Luo (University of California Irvine, Irvine, CA). Construction of a Mammalian Expression Vector. The complete cDNA of human T RII was used as the template for PCR amplification of the coding sequence of the extracellular domain of T RII (nucleotides 1–477 including the signal sequence). PCR was performed using the sense primer, 5 AAGCTTGCCGCCGCCATGGGTCG, and antisense primer, 5 -CTGGAATTCGTCAGGATTGCTGG. The sense primer introduced a HindIII restriction site and the consensus Kozak translation initiation start site. The antisense primer introduced an EcoRI site. The PCR fragment was ligated into the PCRZ.1 vector. The soluble T RII coding fragment was isolated after digestion with HindIII and EcoRV. This gel-purified fragment was subsequently ligated into the HindIII/Eco721-digested pMH expression vector, which is tagged at its COOH terminus with a HA epitope. The constructed vector, pMHsT RII, contained the open reading frame encoding the human soluble T RII and nucleotides encoding nine amino acids of HA. The sequence and orientation was confirmed by dideoxy chain termination sequencing. The pMH plasmid containing the G418 resistance gene (neomycin) was used for construction of control clones (sham) expressing the vehicle vector alone. Cell Culture. COLO-357 human pancreatic cancer cells were grown in DMEM, supplemented with 8% FBS, penicillin (100 units/ml), and streptomycin (100 g/ml), and 5% fungazone termed complete medium. Cells were maintained in monolayer cultures at 37°C in humidified air with 5% CO2. The selection medium for the cell lines containing the neomycin resistance gene was supplemented with 0.4 mg/ml G418. For TGF1 experiments, cells were incubated overnight in serumfree medium (DMEM containing 0.1% BSA, 5 g/ml transferrin, 5 ng/ml sodium selenite, antibiotics, and fungazone). To generate cells expressing the human soluble T RII, COLO-357 cells were transfected in a stable manner with the pMHsT RII plasmid (10 g) using Lipofectamine as reported previously (15). After reaching confluence, cells were split 1:10 into selection medium, and single clones were isolated after 3–4 weeks. After expansion of each individual clone, cells from each clone were screened for expression of soluble T RII by Northern and Western blot analysis. Two clones were selected for additional studies. Immunoblotting and Immunoprecipitation. Exponentially growing human pancreatic and dermal microvascular endothelial cells (50–60% confluent) were washed with ice cold 1 PBS and lysed in buffer containing 1% NP40, 20 mM Tris (pH 8.0), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 2.5 mM sodium phosphate, 1 mM -glycerophosphate, 1 mM sodium vanadate, 1 g/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride. Frozen tumor samples derived from COLO-357 shamtransfected or pMHsT RII clones were homogenized and lysed in the same buffer. Lysates were subjected to SDS-PAGE and electrotransferred to Immobilon-P membranes for 40–80 min. After blocking with 5% milk (1 Tris-buffered saline with 0.1% Tween 20), the membranes were incubated with anti-HA monoclonal antibody (1:1200 dilution), anti-CD31 antibody (1:3000 dilution), washed, and incubated with a secondary horseradish peroxidase-conjugated antibody. After washing, bound antibodies were visualized using enhanced chemiluminescence. To confirm equal loading, membranes were stripped for 20 min at room temperature in either Restore stripping buffer or 30 min at 50°C in buffer containing 2% SDS, 62.5 mM Tris (pH 6.7), and 100 mM 2-mercaptoethanol and blotted with an anti-ERK-2 antibody (1:8000 dilution). For immunoprecipitation with the anti-HA antibody, cells 2932 Soluble T RII Suppresses COLO-357 Cell Tumorigenicity Research. on September 22, 2017. © 2001 American Association for Cancer clincancerres.aacrjournals.org Downloaded from transfected with the soluble T RII expression construct or sham were grown to 80% confluency in complete medium and then incubated for 24 h in serum-free medium. Conditioned medium from the clones or sham-transfected cells was concentrated by using a Mr 10,000 cutoff filtration membrane. The concentrated medium was incubated for 12 h at 4°C with the anti-HA antibody (2 g/ml), followed by a 2-h incubation with protein A agarose (50 l) at 4°C. Precipitates were washed three times with ice-cold PBS, resuspended in 2 loading buffer, and boiled for 5 min at 100°C. After centrifugation, the supernatants were subjected to Western blotting using the biotinylated antihuman T RII polyclonal antibody (1:5000 dilution). Immunohistochemistry. COLO-357 cells were plated in chamber slides and grown to 70% confluency for 48 h. The cells were fixed in 1.5% paraformaldehyde for 45 min at room temperature and incubated sequentially for 30 min (room temperature) with 0.1% Triton X-100, 30 min (room temperature) with 0.3% hydrogen peroxide/methanol, 30 min (37°C) with 1 mg/ml hyaluronidase, and 40 min (room temperature) with 10% normal goat serum. Cells were then incubated for 16 h (4°C) with the highly specific anti-HA antibody (0.4 g/ml) recognizing the HA epitope encoded by pMHsT RII or with the highly specific anti-T RII antibody (0.2 g/ml) recognizing the epitope corresponding to the full-length T RII. To assess T RII, HA, and CD31 immunoreactivity, tumors from s.c. lesions were removed and immediately divided. Tissues were fixed in 4% formaldehyde and embedded in paraffin wax. Paraffin-embedded sections (4 m) from tumor tissue derived from sham-transfected or pMHsT RII-transfected cells were cut and mounted on poly L-lysine-coated glass slides and air-dried overnight at room temperature. Representative sections of each case were examined by the streptavidin-peroxidase technique using appropriate positive and negative controls. Endogenous peroxidase activity was blocked by incubation for 30 min with 0.3% hydrogen peroxidase in methanol. Tissue sections were incubated for 15 min (room temperature) with 10% normal goat serum and then incubated for 16 h at 4°C with anti-HA antibody (0.4 g/ml), anti-T RII antibody (0.2 g/ml), or anti-platelet endothelial cell adhesion molecule-1 antibody (1:50 dilution) in PBS containing 1% BSA. For both cell-line and tissue immunohistochemistry, bound T RII and HA antibodies were detected with biotinylated goat antirabbit IgG secondary antibodies and streptavidin-peroxidase complexes, using diaminobenzidine tetrahydrochloride as the substrate. Sections were counterstained with Mayer’s hematoxylin. Sections incubated with nonimmune rabbit IgG or with secondary antibodies alone did not yield positive immunoreactivity. The frequency of blood vessels in the matrix region of the tumor that was positively stained for PECAM-1 was evaluated morphometrically. Fifty different high-power fields were randomly selected for each specimen, with each high-power field representing 0.25 mm on the microscope grid. RNA Extraction and Northern Blot Analysis. Total RNA was extracted by the single step acid guanidine thiocyanate-phenol-chloroform method (16). RNA was size fractionated on 1.2% agarose/1.8 M formaldehyde gels, electrotransferred onto Genescreen nylon membranes, and cross-linked by UV irradiation (17). The blots were prehybridized and hybridized in 0.75 M NaCl, 5 mM EDTA (pH 8.0), 50 mM sodium phosphate, 50% formamide, 5 Denhardt’s solution, 10% dextran sulfate, 1% SDS, and 100 g/ml salmon sperm DNA with cDNA probes at 42°C. The cDNA probes included a 500-bp HindIII/EcoRI fragment of the human soluble T RII, a 500-bp SacII/Pst-1 fragment of the human PAI-1, and a 190-bp BamHI fragment of mouse 7S ribosomal cDNA, which hybridizes with human cytoplasmic RNA. The 7S probe was used to confirm equal RNA loading (17). Membranes were washed under high stringency conditions (washed two times in 2 SSC at room temperature and two times at 55°C in 0.2 salinesodium phosphate-EDTA/1% SDS). Blots were exposed to Kodak Biomax MS films in cassettes with BioMax Transcreenhigh energy intensifying screens at 80°C. Cell Growth Assays. To assess the growth inhibitory effects of TGF, cell growth was determined by the MTT dye reduction assay, which measures the conversion of the MTT tetrazolium salt into MTT formazan by mitochondrial hexosaminidase (18, 19). Cells were seeded at a density of 10,000 cells/well in 96-well plates in DME complete medium and incubated for 24 h before incubation for 72 h in serum-free medium in the absence or presence of TGF1 (10 pM). The assay was initiated by adding MTT solution at a final concentration of 62.5 g of MTT/well (9, 10). After 4 h, the medium was removed, and the dye crystals were dissolved in acidified isopropanol. The absorbance was measured at 570 nm and 650 nm with an ELISA plate reader (Molecular Devices, Menlo Park, CA). Data were expressed as percentage of unstimulated control cell growth. In pancreatic cancer cells, the results of the MTT assay correspond with results obtained by cell counting with a hemocytometer or by monitoring [H]-thymidine incorporation into DNA (9). In Vivo Tumorigenicity Assay. To assess the effect of the soluble T RII on tumorigenicity, 2 10 or 6 10 cells expressing the empty vector alone (sham) or soluble T RII were injected s.c. into two sites in female athymic (nude) mice. The tumor size was measured weekly until mice were sacrificed 56 days after injection. A portion of the tumor tissue was snap frozen in liquid nitrogen and stored for subsequent RNA and protein analysis. Another portion was prepared for immunohistochemistry studies. Invasion Assay. The invasive ability of the COL0–357 sham-transfected and soluble T RII-transfected pancreatic cancer cells were measured as reported previously (20) with some modifications (21). Briefly, polycarbonate membranes (8m pore size) of the upper compartment of Transwell chambers were coated with 5% Matrigel. COLO-357 cells that were preincubated for 24 h in serum-free medium containing 0.1% BSA in the absence or presence of 400 pM TGF1 were suspended in 100 l of serum-free medium containing 0.1% BSA and placed onto this upper compartment. The lower compartment was then filled with 600 l of serum-free medium containing 0.5% FBS. TGF1 (400 pM) was added to the lower compartment corresponding to chambers that contained cells previously incubated with TGF1. After 16 h, the membranes were fixed in methanol and stained with H&E. Cells on the upper surface of the filter were carefully removed with a cotton swab, and the cells that had migrated through the membrane to the lower surface of the filter were counted in nine different 2933 Clinical Cancer Research Research. on September 22, 2017. © 2001 American Association for Cancer clincancerres.aacrjournals.org Downloaded from fields using a light microscope (magnification, 200). Invasion assays were performed in triplicate. Statistics. Statistical analysis was performed with SigmaStat software (Jandel Scientific, San Raphael, CA) and Prism software (Graphpad Software, Inc., San Diego, CA). Student’s t test was used when indicated. P 0.05 was taken as the level of significance.